Content
50%Weight 40%Scale 1-5Reviews the quality of instructions and guidance provided to agents. Good implementation is clear, handles edge cases, and produces reliable results.
The domain-specific core — parameter tables, BLAST program reference, and executable example commands — is genuinely actionable, and bundle references are real and clearly linked. However, the body is padded with generic template boilerplate and duplicated sections whose cross-references ('See above') point to sections that appear later, which hurts token efficiency, organization, and workflow clarity.
Suggestions
Collapse the duplicated material: keep one 'When to Use', one 'Usage' (with the parameter table and examples), one 'Workflow', and one 'Prerequisites' section, deleting the 'See ## X above' cross-reference blocks entirely.
Cut generic template sections ('Output Requirements', 'Response Template', 'Input Validation', 'Risk Assessment', 'Security Checklist') or replace them with the 3-4 items actually specific to BLAST API calls (e.g., API key handling, retry on HTTP 429, e-value sanity checks).
Merge the three competing execution paths (Workflow, Example Usage run plan, Implementation Details) into one sequenced workflow with a concrete post-run validation step (e.g., check hit count and e-values in the output file before presenting results).
| Dimension | Reasoning | Score |
|---|---|---|
Conciseness | Several padded, low-value sections: the description text is repeated verbatim in 'When to Use' and 'Key Features'; four dangling cross-references ('See `## Features` above', 'See `## Prerequisites` above', 'See `## Usage` above', 'See `## Workflow` above') point to sections that actually appear later; and generic boilerplate ('Output Requirements', 'Response Template', 'Input Validation', 'Risk Assessment', 'Security Checklist') adds tokens without domain-specific value. This matches anchor 2 ('noticeably verbose; several unnecessary explanations or padded sections') and is well below anchor 3, since the redundancy is structural, not incidental. | 2 / 5 |
Actionability | The Usage section gives fully executable, copy-paste-ready commands with real flags and example sequences ('python scripts/main.py --sequence "ATGCGTACGTAGCTAGCTAG" --program blastn --database nt --output results.txt'), plus a concrete parameter table, a BLAST programs table, and verifiable quick-check commands. It misses anchor 5 because guidance elsewhere stays vague ('Reference guidance: references/ contains supporting rules, prompts, or checklists') and the Example Usage path 'cd "20260318/scientific-skills/..."' is not portable. | 4 / 5 |
Workflow Clarity | The 'Workflow' section does list a sequenced process with a scope-validation step and a fallback path, and 'Quick Check' provides a pre-flight compile validation. However, three competing partial sequences (Workflow, Example Usage run plan, Implementation Details) fragment the actual execution path, and there is no run-then-verify-output feedback loop for an external network API where failures (timeouts, empty hits) are common. This fits anchor 3 ('sequence present but checkpoints missing or implicit') rather than anchor 4's 'clear sequence with most checkpoints present'. | 3 / 5 |
Progressive Disclosure | The two bundle references (references/blast_docs.md, references/ncbi_api_guide.md) are real, one level deep, and clearly linked from the '## References' section. But the body interleaves and duplicates whole sections (two Usage sections, two workflow descriptions) with broken 'See above' navigation, and inlines generic template content that should be consolidated or dropped, matching anchor 3 ('some structure but could be better organized') rather than anchor 4's 'most content appropriately placed; minor organization gaps'. | 3 / 5 |
Total | 12 / 20 Passed |